########################################## # # # This program is the standalone version # # of Contig Viewer: # # http://cgpdb.ucdavis.edu/ # # Alexander Kozik and Brian Chan # # Copyright 2004 # # University of California Davis # # # ########################################## ########################################################################## # # # Copyright (C) 2004 University of California at Davis # # UCD Genome Center # # Michelmore lab., Alexander Kozik and Brian Chan # # # # This program is free software. You can redistribute it # # and/or modify it under the terms of the GNU General Public License # # ( http://www.gnu.org ) as published by the Free Software Foundation; # # either version 2 of the License, or (at your option) any later version.# # # # In other words, you are free to modify, copy, or redistribute this # # source code and its documentation in any way you like, but you must # # distribute all derivative versions as free software under the same # # terms that we provided our code to you (i.e. the GNU General Public # # License). This precludes any use of the code in proprietary or # # commercial software unless your source code is made freely available. # # # # This program is distributed in the hope that it will be useful, but # # WITHOUT ANY WARRANTY; without even the implied warranty of # # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU # # General Public License for more details. # # # # You should have received a copy of the GNU General Public License # # along with this Contig Viewer release, in the file LICENSE; # # if not, write to the Free Software Foundation, # # Inc., 675 Mass. Ave, Cambridge, MA 02139 USA. # # # ########################################################################## import os, sys, urllib from Tkinter import * from tkMessageBox import * from tkFileDialog import * from string import * from string import atof from math import log10 from math import fabs import tkFont # ==================================================== # global g_interestListWin = 0 # these are for the interest win g_interestListWin_open = 0 g_interestListIndex = 0 g_interestList_content = None prefix_type = "" db_source = "" g_path = "" g_use_blast = "" g_use_singleton = "" g_phpFilePath = "" g_phpFilePathContigData = "" g_blastFileExt = "" g_blastPath = "" g_hitnum = 7 g_display_GC = "TRUE" g_blastInputFileName = "_x_blast.in" g_blastOutputFileName = "_x_blast.out" g_seqNameCharSpace = 22 # how much space the seqName's occupy # g_tclshCmd = "tclsh8.1" g_tclshCmd = "tclsh" # g_blastParserScriptName = "tcl_blast_parser_123_V025.tcl" g_blastParserScriptName = "tcl_blast_parser_123_V025S.tcl" # ==================================================== class sequenceClass: def __init__(self, sn, sb, s, e): self.seqName = sn # seq name self.seqBody = sb.upper() # seq body self.start = s # start index of seq self.end = e # end index of seq self.D_info = [] # indexes of D (deletions) self.I_info = [] # indexes of I (insertions) self.S_info = [] # indexes of S (substitutions) self.XN_info = [] # indexes of x and N case def getSeqName(self): return self.seqName def getSeqBody(self): return self.seqBody def getSeqBodyChar(self, index): # print index, len(self.seqBody) if index < self.end: return self.seqBody[index] else: return " " def getStart(self): return self.start def getEnd(self): return self.end def append_D_info(self, di): self.D_info.append(di) def getD_info(self): return self.D_info def append_I_info(self, ii): self.I_info.append(ii) def getI_info(self): return self.I_info def append_S_info(self, si): self.S_info.append(si) def getS_info(self): return self.S_info def append_XN_info(self, xni): self.XN_info.append(xni) def getXN_info(self): return self.XN_info # =================================================== class contigViewerUserInputWindow( Frame ): def __init__(self): global prefix_type global db_source global g_path global g_use_blast global g_use_singleton global g_blastFileExt global g_blastPath global g_phpFilePath global g_phpFilePathContigData ############################################################ ##### MODIFY VARIABLES ACCORDING TO PARTICULAR PROJECT ##### ############################################################ prefix_type = 1 # "Prefix_Type_1 (tomato)" db_source = "tomato" g_use_blast = "FALSE" g_use_singleton = "FALSE" g_path = "cgpdb.ucdavis.edu/database/assembly/tomato/" g_blastPath = "cgpdb.ucdavis.edu/database/blast/tomato_vs_tigr/" g_blastFileExt = ".tom_vs_tigr_blastX.txt" g_phpFilePath = "cgpdb.ucdavis.edu/viewer/get_viewer_coordinates.php" g_phpFilePathContigData = "cgpdb.ucdavis.edu/viewer/get_viewer_contig_data.php" # g_phpFilePath = "pgfmars.ucdavis.edu/~bchan/work/get_viewer_coordinates.php" # g_phpFilePathContigData = "pgfmars.ucdavis.edu/~bchan/work/get_viewer_contig_data.php" ############################################################ ##### END OF MODIFICATION ##### ############################################################ # set up the main window Frame.__init__(self) root = self.master root.title("Contig Viewer") # root.geometry( "300x150" ) myRow = 0 # keep track of the row number (for grid manager) ################################## ###### BASIC FUNCTIONALITY ###### frame_0 = Frame(root) frame_0.pack(side = TOP, fill = X) self.basic_label_str = " Basic functions of Contig Viewer: " self.bar_label_0 = Label(frame_0, text=self.basic_label_str) self.bar_label_0.pack() # first row frame_1 = Frame(root) frame_1.pack(side = TOP, fill = X) self.path_label = Label(frame_1, text="Path http://") self.path_label.pack(side = LEFT) ############################################################ ##### MODIFY VARIABLES ACCORDING TO PARTICULAR PROJECT ##### ############################################################ ### URL to download sequences from web server URLarray = ["cgpdb.ucdavis.edu/database/assembly/tomato/", \ "cgpdb.ucdavis.edu/database/assembly/lettuce/", \ "cgpdb.ucdavis.edu/database/assembly/sunflower/", \ "cgpdb.ucdavis.edu/database/assembly/arabidopsis/"] ############################################################ ##### END OF MODIFICATION ##### ############################################################ self.URL_str = StringVar() self.URL_str.set(URLarray[0]) # init the path self.URL_optionMenu = OptionMenu(frame_1, self.URL_str, \ URLarray[0], URLarray[1], URLarray[2], URLarray[3], \ command=self.define_path) self.URL_optionMenu.pack(fill = X) # second row b frame_1b = Frame(root) frame_1b.pack(side = TOP, fill = X) self.sp_label = Label(frame_1b, text="ID Prefix: ") self.sp_label.pack(side = LEFT) ############################################################ ##### MODIFY VARIABLES ACCORDING TO PARTICULAR PROJECT ##### ############################################################ ### ID with suffix or prefix Prefix_array = ["Prefix_Type_1 (tomato)", \ "Prefix_Type_2 (lettuce)", \ "Prefix_Type_3 (sunflower)", \ "Prefix_Type_4 (arabidopsis)"] ### MODIFYING THIS SECTION YOU ALSO NEED TO MODIFY FUNCTION "def define_Prefix" ############################################################ ##### END OF MODIFICATION ##### ############################################################ ####################################################### self.Prefix_str = StringVar() self.Prefix_str.set(Prefix_array[0]) # init the path self.Prefix_optionMenu = OptionMenu(frame_1b, self.Prefix_str, \ Prefix_array[0], Prefix_array[1], Prefix_array[2], \ Prefix_array[3], command=self.define_Prefix) self.Prefix_optionMenu.pack(fill = X) ###################################################### # third row frame_2 = Frame(root) frame_2.pack(side = TOP, fill = X) self.contigID_label = Label(frame_2, text="Contig ID:") self.contigID_label.pack(side = LEFT) self.contigID_text = Entry(frame_2, name="contigID_text") self.contigID_text.bind( "", self.showWebFinding) self.contigID_text.pack(side = LEFT) self.contigID_text.insert(0, "L_ABC_Contig2942") # self.contigID_text.insert(0, "QG_CA_Contig1009") EXTarray = [".aln", ".alignment", ".align", ".ali"] self.EXT_str = StringVar() self.EXT_str.set(EXTarray[0]) # init the ext self.EXT_optionMenu = OptionMenu(frame_2, self.EXT_str, EXTarray[0], EXTarray[1], EXTarray[2], EXTarray[3]) self.EXT_optionMenu.pack(side = RIGHT) self.EXT_label = Label(frame_2, text="File Extension:") self.EXT_label.pack(side = RIGHT) frame_4c = Frame(root) frame_4c.pack(side = TOP, fill = X) self.bar_label_str = "- - - - - - - - - - - - - - - - - - - - - - - - - - - - - -" self.bar_label_a = Label(frame_4c, text=self.bar_label_str) self.bar_label_a.pack() # fourth row myRow = myRow + 1 frame_3 = Frame(root) frame_3.pack(side = TOP, fill = X) self.webButton = Button(frame_3, text=" Get Data Remotely ", command=self.showWebFinding) self.webButton.pack(side = LEFT) self.HDButton = Button(frame_3, text="Choose file form Hard Disk", command=self.showHDFinding) self.HDButton.pack(side = RIGHT) # fifth row frame_4a = Frame(root) frame_4a.pack(side = TOP, fill = X) self.bar_label_str = "=====================================================" self.bar_label_a = Label(frame_4a, text=self.bar_label_str) self.bar_label_a.pack() ################################### ##### EXTENDED FUNCTIONALITY ###### frame_4e = Frame(root) frame_4e.pack(side = TOP, fill = X) self.exp_label_str = " Extended functionality - for experienced users only: " self.bar_label_e = Label(frame_4e, text=self.exp_label_str) self.bar_label_e.pack() frame_4f = Frame(root) frame_4f.pack(side = TOP, fill = X) self.warn_label_str = " (proper database setup is required) " self.bar_label_f = Label(frame_4f, text=self.warn_label_str) self.bar_label_f.pack() ###### USE BLAST REPORT TO DISPLAY INTRON-EXON POSITIONS ####### # blast row c frame_1c = Frame(root) frame_1c.pack(side = TOP, fill = X) self.blast_label = Label(frame_1c, text="Use BLAST Report: ") self.blast_label.pack(side = LEFT) ############################################################### ### USE BLAST Blast_array = ["false", "true"] ############################################################### self.Blast_str = StringVar() self.Blast_str.set(Blast_array[0]) # init the path self.Blast_optionMenu = OptionMenu(frame_1c, self.Blast_str, \ Blast_array[0], Blast_array[1], command=self.define_Blast) self.Blast_optionMenu.pack(fill = X, side = LEFT) self.ignore_label = Label(frame_1c, text=" Singleton: ") self.ignore_label.pack(side = LEFT) Singl_array = ["no", "yes"] self.Singl_str = StringVar() self.Singl_str.set(Singl_array[0]) # init the path self.Singl_optionMenu = OptionMenu(frame_1c, self.Singl_str, \ Singl_array[0], Singl_array[1], command=self.define_Singl) self.Singl_optionMenu.pack(fill = X, side = LEFT) ########################################################## frame_1d = Frame(root) frame_1d.pack(side = TOP, fill = X) self.bl_path_label = Label(frame_1d, text="BLAST http://") self.bl_path_label.pack(side = LEFT) ############################################################ ##### MODIFY VARIABLES ACCORDING TO PARTICULAR PROJECT ##### ############################################################ ### URL to download BLAST report from web server bl_URLarray = ["cgpdb.ucdavis.edu/database/blast/tomato_vs_tigr/", \ "cgpdb.ucdavis.edu/database/blast/lettuce_vs_tigr/", \ "cgpdb.ucdavis.edu/database/blast/sunflower_vs_tigr/", \ "cgpdb.ucdavis.edu/database/blast/ath_vs_tigr/"] ############################################################ ##### END OF MODIFICATION ##### ############################################################ self.bl_URL_str = StringVar() self.bl_URL_str.set(bl_URLarray[0]) # init the path self.bl_URL_optionMenu = OptionMenu(frame_1d, self.bl_URL_str, \ bl_URLarray[0], bl_URLarray[1], bl_URLarray[2], bl_URLarray[3], \ command=self.define_blPath) self.bl_URL_optionMenu.pack(fill = X) frame_7 = Frame(root) frame_7.pack(side = TOP, fill = X) bl_EXTarray = [".tom_vs_tigr_blastX.txt", ".let_vs_tigr_blastX.txt", \ ".sun_vs_tigr_blastX.txt", ".ath_vs_tigr_blastX.txt"] self.bl_EXT_str = StringVar() self.bl_EXT_str.set(bl_EXTarray[0]) # init the ext self.bl_EXT_optionMenu = OptionMenu(frame_7, self.bl_EXT_str, bl_EXTarray[0], bl_EXTarray[1], bl_EXTarray[2], bl_EXTarray[3], \ command=self.define_blFileExt) self.bl_EXT_optionMenu.pack(side = RIGHT) self.bl_EXT_label = Label(frame_7, text="BLAST file extension:") self.bl_EXT_label.pack(side = RIGHT) frame_8 = Frame(root) frame_8.pack(side = TOP, fill = X) self.php_path_label = Label(frame_8, text="coordinates: http://") self.php_path_label.pack(side = LEFT) ############################################################ ##### MODIFY VARIABLES ACCORDING TO PARTICULAR PROJECT ##### ############################################################ ### URL to download BLAST report from web server ### URL to get coordinates for blast php_URLarray = ["cgpdb.ucdavis.edu/viewer/get_viewer_coordinates.php", \ "pgfmars.ucdavis.edu/~bchan/work/get_viewer_coordinates.php", \ "any.custom.url/some_php_script.php (modify)"] ############################################################ ##### END OF MODIFICATION ##### ############################################################ self.php_URL_str = StringVar() self.php_URL_str.set(php_URLarray[0]) # init the path self.php_URL_optionMenu = OptionMenu(frame_8, self.php_URL_str, \ php_URLarray[0], php_URLarray[1], php_URLarray[2], \ command=self.define_phpFilePath) self.php_URL_optionMenu.pack(fill = X) ############################################################ frame_9 = Frame(root) frame_9.pack(side = TOP, fill = X) self.php_contig_data_path_label = Label(frame_9, text="contig data: http://") self.php_contig_data_path_label.pack(side = LEFT) php_URL_cda = ["cgpdb.ucdavis.edu/viewer/get_viewer_contig_data.php", \ "pgfmars.ucdavis.edu/~bchan/work/get_viewer_contig_data.php", \ "any.custom.url/some_php_script.php (modify)"] self.php_URL_contig_data_str = StringVar() self.php_URL_contig_data_str.set(php_URL_cda[0]) # init the path self.php_URL_contig_data_optionMenu = OptionMenu(frame_9, \ self.php_URL_contig_data_str, \ php_URL_cda[0], php_URL_cda[1], php_URL_cda[2], \ command=self.define_phpFilePathContigData) self.php_URL_contig_data_optionMenu.pack(fill = X) ########################################################## ##### END OF BLAST SECTION ##### frame_4b = Frame(root) frame_4b.pack(side = TOP, fill = X) # self.bar_label_str = "=====================================================" self.bar_label_b = Label(frame_4b, text=self.bar_label_str) self.bar_label_b.pack() # make menu self.makemenu() # --------------------------------------------------- def define_phpFilePathContigData(self, somewhere): global g_phpFilePathContigData g_phpFilePathContigData = somewhere print "PHP contig data file path: " + g_phpFilePathContigData def define_path(self, somewhere): global g_path g_path = somewhere print "path: " + g_path def define_phpFilePath(self, something): global g_phpFilePath g_phpFilePath = something print "PHP file path: " + g_phpFilePath def define_blFileExt(self, something): global g_blastFileExt g_blastFileExt = something print "Blast file extension: " + g_blastFileExt def define_blPath(self, somewhere): global g_blastPath g_blastPath = somewhere print "Blast path: " + g_blastPath def define_Singl(self, somehow): global g_use_singleton print somehow if somehow == "no": g_use_singleton = "FALSE" if somehow == "yes": g_use_singleton = "TRUE" print "SEQUENCE IS SINGLETON: " + g_use_singleton def define_Blast(self, whatever): global g_use_blast print whatever if whatever == "false": g_use_blast = "FALSE" if whatever == "true": g_use_blast = "TRUE" print "BLAST RESULTS: " + g_use_blast # --------------------------------------------------- def define_Prefix(self, something): global prefix_type global db_source # print "I am here!" print something prefix_type = 0 ############################################################ ##### MODIFY VARIABLES ACCORDING TO PARTICULAR PROJECT ##### ############################################################ if something == "Prefix_Type_1 (tomato)": prefix_type = 1 db_source = "tomato" if something == "Prefix_Type_2 (lettuce)": prefix_type = 2 db_source = "lettuce" if something == "Prefix_Type_3 (sunflower)": prefix_type = 3 db_source = "sunflower" if something == "Prefix_Type_4 (arabidopsis)": prefix_type = 4 db_source = "arabidopsis" ############################################################ ##### END OF MODIFICATION ##### ############################################################ print prefix_type print db_source # --------------------------------------------------- def makemenu(self): self.menubar = Menu(self.master) self.master.config(menu=self.menubar) # add file pulldown menu file = Menu(self.menubar) file.add_command(label='Quit', command=self.quit) self.menubar.add_cascade(label='File', underline=0, menu=file) # add help pulldown menu help = Menu(self.menubar) help.add_command(label='About', command=self.openAboutWin1) help.add_command(label='Input Files', command=self.openAboutWin2) help.add_command(label='Color Scheme', command=self.openAboutWin3) help.add_command(label='Key Bindings', command=self.openAboutWin4) help.add_command(label='Extended funct.', command=self.openAboutWin5) help.add_command(label='Search for substring', command=self.openAboutWin6) help.add_command(label='PerlPrimer', command=self.openAboutWin7) self.menubar.add_cascade(label='Help', underline=0, menu=help) # --------------------------------------------------- def quit(self): if askyesno('Really quit?', 'Are you sure you want to quit?'): Frame.quit(self) # --------------------------------------------------- def openAboutWin1(self): s = """ This program is the standalone program of the online version of Contig Viewer. (http://cgpdb.ucdavis.edu) It visualizes CAP3 alignments and highlights sequences of different genotypes by different colors. It displayes all SNPs/InDels in a given alignment. It helps to find (specify) regions on CAP3 alignment for oligo design. http://cgpdb.ucdavis.edu/SNP_Discovery/ Authors: Alexander Kozik and Brian Chan email: akozik@atgc.org """ message_box = Toplevel() message_box.title("About Contig Viewer") message_box_fr = Frame(message_box) message_box_fr.pack(expand=0, fill=BOTH) message_lb = Label(message_box_fr, text = s) message_lb.grid(row=0, column=0) quitbutton = Button(message_box_fr, text = 'Close', command=message_box.destroy, borderwidth=1) quitbutton.grid(row=1, column=0) # --------------------------------------------------- def openAboutWin2(self): s = """ File input: modified CAP3 alignment 1. Remotely via http or 2. from local hard drive Contig ID examples: tomato - "L_ABC_Contig2942" number range: 1 - 3821 lettuce - "QG_CA_Contig6125" number range: 1 - 8179 sunflower - "QH_CA_Contig901" number range: 1 - 6760 arabidopsis - "ATH_Contig2931" number range: 1 - 9487 Alignment file extension: tomato - ".aln" lettuce - ".alignment" sunflower - ".alignment" arabidopsis - ".align" for customization see source code """ message_box = Toplevel() message_box.title("Input Files") message_box_fr = Frame(message_box) message_box_fr.pack(expand=0, fill=BOTH) message_lb = Label(message_box_fr, text = s) message_lb.grid(row=0, column=0) quitbutton = Button(message_box_fr, text = 'Close', command=message_box.destroy, borderwidth=1) quitbutton.grid(row=1, column=0) # --------------------------------------------------- def openAboutWin3(self): s = """ Color Scheme: tomato ID prefix: "A_" - lightblue "B_" - yellow "C_" - green "D_" - orange lettuce and sunflower third letter in ID: "A, B, C, D or I" - orange "E, F, G, H or J" - green "K or L" - lightblue "M or N" - yellow to customize see and change source code under comments "MODIFY VARIABLES ACCORDING TO PARTICULAR PROJECT" """ message_box = Toplevel() message_box.title("Color Scheme") message_box_fr = Frame(message_box) message_box_fr.pack(expand=0, fill=BOTH) message_lb = Label(message_box_fr, text = s) message_lb.grid(row=0, column=0) quitbutton = Button(message_box_fr, text = 'Close', command=message_box.destroy, borderwidth=1) quitbutton.grid(row=1, column=0) # --------------------------------------------------- def openAboutWin4(self): s = """ Key bindings (Windows and *nix three button mouse): Left mouse button: set the left index (L) Right mouse button: set the right index (R) Middle mouse button: set the middle index (M) Control + Left mouse button: set the middle index (M) Shift + Left mouse button: set the left exclude index (LX) Shift + Right mouse button: set the right exclude index (RX) ---------------------- Note to Mac OS X users: Key binding on three button mouse may be slightly different. Check it out before usage. """ message_box = Toplevel() message_box.title("Key Binding") message_box_fr = Frame(message_box) message_box_fr.pack(expand=0, fill=BOTH) message_lb = Label(message_box_fr, text = s) message_lb.grid(row=0, column=0) macXbutton = Button(message_box_fr, text = 'Mac OS X notes', command=self.mac_OSX_notes, borderwidth=1, bg="gold") macXbutton.grid(row=1, column=0) quitbutton = Button(message_box_fr, text = 'Close', command=message_box.destroy, borderwidth=1) quitbutton.grid(row=2, column=0) # --------------------------------------------------- def mac_OSX_notes(self): s = """ MAC OS X NOTES: There is a bug (annoyance): When you use Contig Viewer in the Extended mode, "Sequence Text" window with alignment may look slightly shacking and other windows may not respond. In this case close "Sequence Text" window and open it again by clicking anywhere on graphical contig "Viewer" window. After this action program should restore normal functionality. ------------------- Three button mouse key binding: Right button may act as a middle button compare to PC mouse on Python Mac OS X interpreter. Middle button (or wheel) may act as a right button compare to regular bindings as described in help. You need to practice a little bit to get familiar with mouse functionality. """ message_box = Toplevel() message_box.title("Key Binding") message_box_fr = Frame(message_box) message_box_fr.pack(expand=0, fill=BOTH) message_lb = Label(message_box_fr, text = s) message_lb.grid(row=0, column=0) quitbutton = Button(message_box_fr, text = 'Close', command=message_box.destroy, borderwidth=1) quitbutton.grid(row=1, column=0) # --------------------------------------------------- def openAboutWin5(self): s = """ Extended functionality will be activated upon selection "Use BLAST Report - true" Program will contact web server and run set of scripts and queries on database (proper database setup is required). Program will extract data from BLAST report corresponding to specified Contig (sequence) and display BLAST hits with intron/exon positions on corresponding Arabidopsis sequences. This functionality is under development. See details about database setup and instructions at: http://cgpdb.ucdavis.edu/SNP_Discovery/Py_ContigViewer/ """ message_box = Toplevel() message_box.title("Extended Functionality") message_box_fr = Frame(message_box) message_box_fr.pack(expand=0, fill=BOTH) message_lb = Label(message_box_fr, text = s) message_lb.grid(row=0, column=0) quitbutton = Button(message_box_fr, text = 'Close', command=message_box.destroy, borderwidth=1) quitbutton.grid(row=1, column=0) # --------------------------------------------------- def openAboutWin6(self): s = """ There is a search feature in the text sequence window. You can insert the search string into the forward search text field. The "case sensitive" check box indicates whether you want your search to be case sensitive. You can also input the reverse complement of your search string by either manually typing it, or by press the button labeled "Get Rev-Comp". The "search" button will perform the substring search on the two patterns in the Forward and Rev-Comp text fields. The Forward substring match will be colored in purple. the Reverse Complement substring match will be colored in green. The sequence text display will shift to the first found match. The button "Clear Selection" will clear the colors in the text sequence window. """ message_box = Toplevel() message_box.title("Search for substring") message_box_fr = Frame(message_box) message_box_fr.pack(expand=0, fill=BOTH) message_lb = Label(message_box_fr, text = s) message_lb.grid(row=0, column=0) quitbutton = Button(message_box_fr, text = 'Close', command=message_box.destroy, borderwidth=1) quitbutton.grid(row=1, column=0) # --------------------------------------------------- def openAboutWin7(self): s = """ Upon selection of regions for PCR oligo design there is an option to generate a fasta file which can be used by PerlPrimer program: http://perlprimer.sourceforge.net/ After selection is done (you see two yellow boxes on the "Sequence Text" window and all fields in the "Indexes" window are filled), you can click "PerlPrimer" button. New file in fasta format will be generated like: >Contig2942 5prime_region[189-265] 3prime_region[332-411] GGTTCCAATGGAGTTGTGATAAACGAAGAGCAGCACAAGCTCCCAATACCAAATTTAG TACTACTGACCAATTATAAAGAGTAAATATAGAAGATTAGGGTTTTAAGATCTCTAAC AAAATTGCACTGGGAAGAATCTGGTTCTTCAATTTTCTGGGATTTATCAGATCTGAAG AAACTGAAGAGTGAAGTGGTAATCGTTGATAAGTGTATGTTCAAGGGAGGATTGTTTG GATTTACTGAACTGTTGTTTGATGTGGTTTTGGAGAAGATAA where "5prime_region" and "3prime_region" fields contain numerical values for selected regions for oligo design. These values can be used by PerlPrimer or Primer3 programs. PerlPrimer program can read this fasta file format directly. """ message_box = Toplevel() message_box.title("PerlPrimer") message_box_fr = Frame(message_box) message_box_fr.pack(expand=0, fill=BOTH) message_lb = Label(message_box_fr, text = s, justify=LEFT) message_lb.grid(row=0, column=0) quitbutton = Button(message_box_fr, text = 'Close', command=message_box.destroy, borderwidth=1) quitbutton.grid(row=1, column=0) # --------------------------------------------------- def showWebFinding(self, event=0): self.showFinding("website") # --------------------------------------------------- def showHDFinding(self, event=0): self.showFinding("Hard-Drive") # --------------------------------------------------- def showFinding( self, type ): global g_use_blast global g_use_singleton global g_path # flags no_blast_flag = 0 if g_use_blast == "FALSE": no_blast_flag = 1 if g_use_blast == "TRUE": no_blast_flag = 0 if g_use_singleton == "FALSE": singleton_flag = 0 if g_use_singleton == "TRUE": singleton_flag = 1 # get raw data rawData = "" if type == "website": rawData = self.getWebData() elif type == "Hard-Drive": rawData = self.getHDData() # retrieve separated data sequences_data, MM_info = self.getSequencesData(rawData) if sequences_data == "": singleton_flag = 1 # get gap info gapInfo = [] blastResult = [] hitnum = 0 if no_blast_flag == 0: gapInfo = self.getGapInfo(g_blastInputFileName, g_blastOutputFileName) print gapInfo # then pass gapInfo to cv, so that the gaps will be printed out # retrieve blast result data info2_list, webBlastResultData, hitnum, no_tigr_seq_flag = self.getBlastResultData() if len(webBlastResultData) != len(info2_list): showinfo('Error', "blast result contains different number of tigr sequences than that of info2") # there is error, probably one of the tigrID's is wrong #showinfo('Error', "invalid blast result data") if no_tigr_seq_flag != 1: for blastResult_i in range( hitnum ): info2Line = info2_list[blastResult_i] dirPosLine = webBlastResultData[blastResult_i] [contigID, tigrID, desp, norm_exp, identity, matches, overlap, \ hit_N, Frame, est_s, est_e, ath_s, ath_e, len2, gaps] = info2Line [dir, pos] = split(dirPosLine) [seqLen1, seqLen2] = split(len2, "/") [est_s, est_e, ath_s, ath_e] = [int(est_s), int(est_e), int(ath_s), int(ath_e)] [seqLen1, seqLen2] = [int(seqLen1), int(seqLen2)] array1 = [tigrID, est_s, est_e, ath_s, ath_e, seqLen1, seqLen2] array2 = [dir, pos] blastResultData_record = [array1, array2] #print blastResultData_record blastResult.append( blastResultData_record ) print blastResult # else: # singleton_flag = 1 # if it is a singleton, we need extra info seqName = self.contigID_text.get() if singleton_flag != 0: # overwrite the error page, with the seq body if g_use_singleton == "TRUE": # use online script, getting data from the database rawData = self.getWebContigData() seqBody = rawData[0] # should only have one line else: pagename = g_path + self.contigID_text.get() + self.EXT_str.get() remoteaddr = 'http://' + pagename remotefile = urllib.urlopen(remoteaddr) remotedata = remotefile.readlines() remotefile.close() lastLine = remotedata[-1] n, b = split(lastLine) seqBody = strip(b) # sequences_data should be empty, so add the singleton sequence = sequenceClass(seqName, seqBody, 1, len(seqBody)) sequences_data = [ sequence ] MM_info = [] # generate picture cv = contigViewerClass(seqName, rawData, sequences_data, MM_info, hitnum, blastResult, gapInfo) cv.generatePicture() cv.generateSeqTextWin() if no_blast_flag == 0: cv.generateBlastResultTextWin(g_blastInputFileName) else: print "not displaying blast result" pass # no blast result retrieved # --------------------------------------------------- def getGapInfo(self, savefileName="_input.txt", outfileName="_out.txt"): global g_blastPath global g_blastFileExt global g_tclshCmd global g_blastParserScriptName # get blast result online. (assuming the file comes without any problems) contigID = self.contigID_text.get() blastPage = g_blastPath + contigID + g_blastFileExt self.getWebFileAndSave(blastPage, savefileName) # analysize the blast result tclshCmd = g_tclshCmd inputName = savefileName outputName = outfileName options = "10 20 50 MATRIX" blastParserScriptName = g_blastParserScriptName cmdStr = tclshCmd + " " + blastParserScriptName + " " + inputName + " " + outputName + " " + options print cmdStr os.system(cmdStr) # find gaps global g_hitnum alignfilename = outputName + ".align" info2filename = outputName + ".info2" alignFile = open(alignfilename, "r") lines = alignFile.readlines() numLine = len(lines) #hitnum_limit = atoi( self.hitnum_text.get() ) hitnum_limit = g_hitnum gapInfo = [] i = 0 # curr line number while i < numLine: # get a record (5 lines) hitLine = lines[i] contigNameLine = lines[i+1] contigBodyLine = lines[i+2] tigrNameLine = lines[i+3] tigrBodyLine = lines[i+4] # analysis # analysize hitLine tempList = split(hitLine) hitNum = atoi(tempList[2]) ALT_ALN_num = atoi(tempList[4]) if hitNum > hitnum_limit: # increment the current line pointer i = i + 5 continue if ALT_ALN_num != 1: # increment the current line pointer i = i + 5 continue # analysize contigNameLine tempList = split(contigNameLine) contigName = tempList[0][1:] rangeStr = strip(tempList[1], "[]") tempList = split(rangeStr, "-") contigStart = atoi(tempList[0]) contigEnd = atoi(tempList[1]) # analysize contigBodyLine contigBody = strip(contigBodyLine) # analysize tigrNameLine tempList = split(tigrNameLine) tigrName = tempList[0][1:] rangeStr = strip(tempList[1], "[]") tempList = split(rangeStr, "-") tigrStart = atoi(tempList[0]) tigrEnd = atoi(tempList[1]) # analysize tigrBodyLine tigrBody = strip(tigrBodyLine) # good record, find gap lenC = len(contigBody) lenT = len(tigrBody) if lenC != lenT: print "lenC and lenT are different, can't find gap" # increment the current line pointer i = i + 5 continue gapListC = [] gapListT = [] for char_i in range(lenC): charC = contigBody[char_i] charT = tigrBody[char_i] if charC == "-" and charT == "-": print "charC and charT are both - ..." return if charC != "-" and charT != "-": continue # no gap if charC == "-": gapListC.append(char_i*3) gapListC.append(char_i*3+1) gapListC.append(char_i*3+2) if charT == "-": gapListT.append(char_i*3) gapListT.append(char_i*3+1) gapListT.append(char_i*3+2) record = [ hitNum, gapListC, gapListT ] gapInfo.append( record ) # increment the current line pointer i = i + 5 return gapInfo # --------------------------------------------------- def dispCoord(self): info2_list, webBlastResultData, hitnum, no_tigr_seq_flag = self.getBlastResultData() print info2_list print webBlastResultData print hitnum print no_tigr_seq_flag # --------------------------------------------------- def getSequencesData(self, data): # init global g_use_singleton sequences_data = [] MM_info = [] # error detection if data == "" and g_use_singleton == "FALSE": # no file selected, or file is empty return "ERROR", "ERROR" if find(data[0], ". :") == -1 and g_use_singleton == "FALSE": # the first line should contain "
"
			showinfo('Error', 'Input data is invalid')
			return "ERROR", "ERROR"

		# get each seq's name, body, start, end, MM_info
		for line in data:
			# ignore empty lines
			if strip(line) == "":
				continue
			# ignore lines with ".   :"
			#### FIND CONTIG CONSENSUS [DEFINED BY "-------------------------------------------------------" AT LEAST 60 TIMES]
			if find(line, ".    :") != -1 or find(line, "--------------------------------------------------------") != -1:
				continue
			seqName = ""
			seqBody = ""
			global g_seqNameCharSpace
			for i in range(len(line)):
				if i < g_seqNameCharSpace:    # read in seqName
					seqName = seqName + line[i]
				else:
					seqBody = seqBody + line[i]
			seqName = rstrip(seqName)
			seqBody = rstrip(seqBody)
			print seqName
			# print seqBody, len(seqBody), len(lstrip(seqBody))
			# get start index
			start = len(seqBody) - len(lstrip(seqBody)) + 1
			# get end index, and MM info (MM_info contains D, I and S indexes)
			end = len(rstrip(seqBody))
			seqBodyWithoutTags = seqBody
			# store data
			sequence = sequenceClass(seqName, seqBodyWithoutTags, start, end)
			sequences_data.append( sequence )

		# get contig index among the seq's and the end index of the contig
		contigIndex = len(sequences_data)-1   # index of the contig
		contigEnd = sequences_data[contigIndex].getEnd()

		# find all DIS and store indexes into MM_info
		MM_info = []
		for i in range(contigEnd):
			contigGene = sequences_data[contigIndex].getSeqBodyChar(i)
			for seqIndex in range(len(sequences_data)-1):
				gene = sequences_data[seqIndex].getSeqBodyChar(i)
				if gene == " ":    # gene doesn't exist
					continue
				if gene != contigGene:
					MM_info.append(i)
					break

		# analyze the D, I and S locations
		for mm in MM_info:      # for each MM location
			# get a column from seq's
			gene_array = []
			for seq in sequences_data:
				gene_array.append( seq.getSeqBodyChar(mm) )
			# distinguish it (D, I or S ?)
			contig_gene = gene_array.pop()    # this is the contig gene
			# NUCL = "ATGCNX"
			NUCL ="ABCDEFGHIJKLMNOPQRSTUVWXYZ"
			for i in range(len(gene_array)):
				gene = gene_array[i].upper()
				if gene == " ":           # ignore whte space
					continue
				if gene == contig_gene:   # the same? good
					continue
				if gene == 'X' and contig_gene == 'N':      # x and N case
					sequences_data[i].append_XN_info( mm )
					continue
				if gene in NUCL and contig_gene == '-':     # insertion
					sequences_data[i].append_I_info( mm )
					continue
				if gene == '-' and contig_gene in NUCL:     # deletion
					sequences_data[i].append_D_info( mm )
					continue
				if gene in NUCL and contig_gene in NUCL and gene != contig_gene:   # substitution
					sequences_data[i].append_S_info( mm )
					continue
				showinfo('Error', contig_gene + " " + gene + " " + str(i) + '\n' + "  Wrong nucleotide symbol  ")

		# determine the N area (gray area) in the contig
		contig_index = len(sequences_data) - 1
		contig_body = sequences_data[ contig_index ].getSeqBody()
		for i in range(len(contig_body)-2):
			gene1 = contig_body[i]
			gene2 = contig_body[i+1]
			gene3 = contig_body[i+2]
			### ? WHY 3 POSITIONS ? ###
			if gene1 == "N" and gene2 == "N" and gene3 == "N":
				sequences_data[ contig_index ].append_XN_info(i)
				# Notice, in fact we should store i, i+1, i+2
				#  but we only store i to avoid repeated data

		# return back all the analyzed data
		return sequences_data, MM_info

  # ---------------------------------------------------

	def getWebData(self):
		#pagename = self.URL_str.get() + self.contigID_text.get() + self.EXT_str.get()
		pagename = g_path + self.contigID_text.get() + self.EXT_str.get()
		remoteaddr = 'http://' + pagename
		remotefile = urllib.urlopen(remoteaddr)
		remotedata = remotefile.readlines()
		remotefile.close()
		return remotedata

  # ---------------------------------------------------

	def getHDData(self):
		filename = askopenfilename()
		all_lines = ""
		if filename:
			all_lines = open(filename, 'r').readlines()
		return all_lines

  # ---------------------------------------------------

	def getBlastResultData(self):
		global g_hitnum
		no_tigr_seq_flag = 0
		# get data from info2
		info2Lines = self.getAllTigrInfoFromInfo2()
		info2_list = []
		tigrID_list = []
		#hitnum = atoi(self.hitnum_text.get())
		hitnum = g_hitnum
		# error checking
		if len(info2Lines) == 0 or find(info2Lines[0], "no_hits_found") != -1:
			no_tigr_seq_flag = 1
			return [ [], [], hitnum, no_tigr_seq_flag ]
		elif len(info2Lines) < hitnum:
			hitnum = len(info2Lines)
			showinfo('Error', "Only " + str(hitnum) + " hit(s) available. Click OK to display up to " + str(hitnum) + " hit(s).")
		# gather info
		for line_i in range( len(info2Lines) ):
			if line_i == hitnum:
				break
			line = info2Lines[line_i]
			print line
			lineInfo = [contigID, tigrID, desp, norm_exp, identity, matches, overlap, \
				hit_N, Frame, est_s, est_e, ath_s, ath_e, len2, gaps] = split(line, "\t")
			info2_list.append( lineInfo )
			tigrID_list.append( tigrID )
		tigrID_list_str = join(tigrID_list, ",")
		# get dir and pos data from web
		global g_phpFilePath
		pagename = g_phpFilePath + "?" + tigrID_list_str
		remoteaddr = 'http://' + pagename
		remotefile = urllib.urlopen(remoteaddr)
		remotedata = remotefile.readlines()
		remotefile.close()
		return [info2_list, remotedata, hitnum, no_tigr_seq_flag]



  # ---------------------------------------------------

	def getAllTigrInfoFromInfo2(self):
		info2filename = g_blastOutputFileName + ".info2"
		fp = open(info2filename, "r")
		lines = fp.readlines()
		return lines

  # ---------------------------------------------------

	def getWebContigData(self):
		global g_phpFilePathContigData
		pagename = g_phpFilePathContigData + "?" + self.contigID_text.get()
		remoteaddr = 'http://' + pagename
		remotefile = urllib.urlopen(remoteaddr)
		remotedata = remotefile.readlines()
		remotefile.close()
		return remotedata

  # ---------------------------------------------------

	def getWebFileAndSave(self, url, saveLoc):
		remoteaddr = 'http://' + url
		print remoteaddr
		remotefile = urllib.urlopen(remoteaddr)
		fp_save = open(saveLoc, "w")
		for line in remotefile.readlines():
			fp_save.write(line)
		fp_save.close()
		remotefile.close()

# ===================================================

class contigViewerClass( Frame ):

	def __init__(self, contigName, rawData, sequences_data, MM_info, hitnum, blastResult, gapInfo):

		global prefix_type
		global g_seqNameCharSpace

		print "Prefix type: " + `prefix_type`

		# init this class
		self.contigName = contigName
		self.rawData = rawData          # the seq's and the contig data
		self.sequences_data = sequences_data # the seq array
		self.MM_info = MM_info         # the union of D's, I's and S's
		self.queryID = contigName
		self.hitnum = hitnum
		self.blastResult = blastResult
		self.gapInfo = gapInfo

		self.CVLTRWin_open = 0          # the ContigViewer LTR Win open indicator
		self.interestListWin_open = 0   # the interest list Win open indicator
		self.seqNameCharSpace = g_seqNameCharSpace  # how much space the seqName's occupy

		# constants for the graph
		self.graphChartSizeX = 600      # the left part of the image (histogram)
		self.textChartSizeX = 150       # the middle part of the image (seq names)
		self.tagChartSizeX = 50         # the right part of the image (tag ID)
		self.hSpace = 50                # horizontal empty space
		self.vSpace = 10                # vertical empty space
		self.viewableSizeY = 500        # vertical size of the contig window
		self.GCContentSizeY = 100       # vertical height of the QC bar chart

		# actual graph chart sizeX
		self.adjustedGraphChartSizeX = self.graphChartSizeX - self.hSpace * 2
		self.barHeight = 9              # the height of the bar of seqs
		self.maxImageSizeX = self.graphChartSizeX + self.textChartSizeX + self.tagChartSizeX
		self.maxImageSizeY = 0          # total Y pixels (not known yet, depends on # of seq's)
		self.maxGeneLen = 0             # end of contig  (not known yet)
		self.num_display = 0            # how many seq needs to be displayed (not known yet)
		self.charSpace = 3              # the # of pixel to display a char (horizontally)

		# calculate the dimensions' parameters
		self.numOfBars = len(self.sequences_data)
		self.maxGeneLen = self.sequences_data[len(self.sequences_data)-1].getEnd() * 1.0
		self.contigIndex = len( self.sequences_data ) - 1
		self.contigName = self.sequences_data[self.contigIndex].getSeqName()
		self.contigLength = len(self.sequences_data[self.contigIndex].getSeqBody())

  # ---------------------------------------------------

	def generateBlastResultTextWin(self, savefileName="input.txt"):

		# setup up a new window and a new Text object
		self.BlastResultTextWin = Toplevel()
		self.BlastResultTextWin.title("Blast Result *" + self.contigName + "*")
		self.BlastResultTextWin.geometry( "700x500" )
		text_h = self.numOfBars
		if text_h > 20:
			text_h = 20
		myFont = tkFont.Font(family="Courier", size="10")
		frame_1 = Frame(self.BlastResultTextWin)
		frame_1.pack(side = TOP, fill = BOTH, expand = True)
		self.BlastResultTextWin_content = Text(frame_1, height=text_h, width=10, wrap=NONE, font=myFont)
		self.BlastResultTextWin_open = 1          # indicate open
		self.BlastResultTextWin.bind('', self.BlastResultTextWinDestroy)
		self.BlastResultTextWin_content.pack(side = LEFT, fill = BOTH, expand = True)

		# insert the text into the text win
		fp_in = open(savefileName, "r")
		lines = fp_in.readlines()
		for i in range( len(lines) ):
			line = lines[i]
			myPos = "%s.0" % (str(i+1))
			self.BlastResultTextWin_content.insert(myPos, line)

		# set up scrollable bars
		vertical_scrollbar = Scrollbar(frame_1, orient=VERTICAL, command=self.BlastResultTextWin_content.yview)
		vertical_scrollbar.pack(side = LEFT, fill = BOTH)

		frame_2 = Frame(self.SeqTextWin)
		frame_2.pack(side = TOP, fill = BOTH)
		horizontal_scrollbar = Scrollbar(frame_2, orient=HORIZONTAL, command=self.BlastResultTextWin_content.xview)
		horizontal_scrollbar.pack(side = BOTTOM, fill = X)
		self.BlastResultTextWin_content.config(yscrollcommand=vertical_scrollbar.set)
		self.BlastResultTextWin_content.config(xscrollcommand=horizontal_scrollbar.set)


	def BlastResultTextWinDestroy(self, o=None):
		self.BlastResultTextWin_open = 0

  # ---------------------------------------------------

	def generateSeqTextWin(self):

		# setup up a new window and a new Text object
		self.SeqTextWin = Toplevel()
		self.SeqTextWin.title("Sequence Text *" + self.contigName + "*")
		self.SeqTextWin.geometry( "750x350" )
		text_h = self.numOfBars
		if text_h > 20:
			text_h = 20
		myFont = tkFont.Font(family="Courier", size="10")
		frame_1 = Frame(self.SeqTextWin)
		frame_1.pack(side = TOP, fill = BOTH, expand = True)
		self.SeqTextWin_content = Text(frame_1, height=text_h, width=10, wrap=NONE, font=myFont)
		self.SeqTextWin_open = 1          # indicate open
		self.SeqTextWin.bind('', self.SeqTextWinDestroy)
		self.SeqTextWin_content.pack(side = LEFT, fill = BOTH, expand = True)

		# insert the ruler
		ruler = ""
		for i in range(self.seqNameCharSpace):
			ruler += " "
		for i in range(self.contigLength):
			if i % 10 == 4:
				ruler += "."
			elif i % 10 == 9:
				ruler += ":"
			else:
				ruler += " "
		self.SeqTextWin_content.insert("1.0", ruler+"\n")

		# insert the text into the text win
		for i in range(self.numOfBars):
			seqBody = self.sequences_data[i].getSeqBody()
			seqName = self.sequences_data[i].getSeqName()
			for j in range(self.seqNameCharSpace-len(seqName)):  # make the names aligned
				seqName += " "
			index = i + 2
			if i == self.numOfBars - 1:   # add a line before the contig
				myPos = "%s.0" % (str(index))
				line = ""
				for line_i in range(self.seqNameCharSpace):
					line += " "
				for line_i in range(self.contigLength):
					line += "-"
				self.SeqTextWin_content.insert(myPos, line+"\n")
				index = index + 1
			myPos = "%s.0" % (str(index))
			self.SeqTextWin_content.insert(myPos, seqName+seqBody+"\n")
			# associate tags to DIS
			self.addDISTag(self.sequences_data[i].getD_info(), 'deletion_tag', index)
			self.addDISTag(self.sequences_data[i].getI_info(), 'insertion_tag', index)
			self.addDISTag(self.sequences_data[i].getS_info(), 'substitution_tag', index)
			# add contig name info binding
			self.addInfoBinding(seqName, i, index)
			self.SeqTextWin_content.update()

		# highlight the tags
		self.SeqTextWin_content.tag_config('spectator_tag', foreground='blue')
		self.SeqTextWin_content.tag_config('deletion_tag', foreground='red')
		self.SeqTextWin_content.tag_config('insertion_tag', foreground='red')
		self.SeqTextWin_content.tag_config('substitution_tag', foreground='red')

		# set up scrollable bars
		vertical_scrollbar = Scrollbar(frame_1, orient=VERTICAL, command=self.SeqTextWin_content.yview)
		vertical_scrollbar.pack(side = LEFT, fill = BOTH)

		frame_2 = Frame(self.SeqTextWin)
		frame_2.pack(side = TOP, fill = BOTH)
		horizontal_scrollbar = Scrollbar(frame_2, orient=HORIZONTAL, command=self.SeqTextWin_content.xview)
		horizontal_scrollbar.pack(side = BOTTOM, fill = X)
		self.SeqTextWin_content.config(yscrollcommand=vertical_scrollbar.set)
		self.SeqTextWin_content.config(xscrollcommand=horizontal_scrollbar.set)

		# save alignment button
		frame_3 = Frame(self.SeqTextWin)
		frame_3.pack(side = TOP, fill = BOTH)
		saveAlignmentButton = Button(frame_3, text="Save Alignment As..", command=self.saveAlignment)
		saveAlignmentButton.pack(side = BOTTOM)

		# search forward text
		frame_search = Frame(self.SeqTextWin)
		frame_search.pack(side = TOP, fill = X)
		self.textSearch_label = Label(frame_search, text="Forward:", width=10)
		self.textSearch_label.pack(side = LEFT)
		self.textSearch_text = Entry(frame_search, name="textSearch_text", width=50)
		# self.textSearch_text.bind( "", self.showTextSearch)
		self.textSearch_text.pack(side = LEFT)
		self.textSearch_text.insert(0, "ATTTACTGAACTGTTGTTTGATGTGGTTTTG")

		self.caseSensitiveFlag = IntVar()
		self.caseSensitiveCheckBtn = Checkbutton(frame_search, text="Case Sensitive", variable=self.caseSensitiveFlag, width=16)
		self.caseSensitiveCheckBtn.pack(side=LEFT)
		getRevCompButton = Button(frame_search, text="Get Rev-Comp", command=self.showRevComp, width=16)
		getRevCompButton.pack(side = LEFT)

		# search reverse complement text
		frame_search2 = Frame(self.SeqTextWin)
		frame_search2.pack(side = TOP, fill = X)
		self.textSearchRevComp_label = Label(frame_search2, text="Rev-Comp:", width=10)
		self.textSearchRevComp_label.pack(side = LEFT)
		self.textSearchRevComp_text = Entry(frame_search2, name="textSearchRevComp_text", width=50)
		self.textSearchRevComp_text.pack(side = LEFT)
		self.textSearchRevComp_text.insert(0, "")

		searchButton = Button(frame_search2, text="Search", command=self.showTextSearch, width=16, bg="lightgreen")
		searchButton.pack(side = LEFT)

		searchClearButton = Button(frame_search2, text="Clear Selection", command=self.showTextSearchClear, width=16)
		searchClearButton.pack(side = LEFT)

  # ---------------------------------------------------

	def showRevComp(self):
		T = self.textSearch_text.get()
		comp = ""
		for t in T:
			n = t
			if t == 'A':
				n = 'T'
			elif t == 'a':
				n = 't'
			elif t == 'T':
				n = 'A'
			elif t == 't':
				n = 'a'
			elif t == 'G':
				n = 'C'
			elif t == 'g':
				n = 'c'
			elif t == 'C':
				n = 'G'
			elif t == 'c':
				n = 'g'
			comp += n
		revComp = ""
		for c in comp:
			revComp = c + revComp
		self.textSearchRevComp_text.delete(0, END)
		self.textSearchRevComp_text.insert(0, revComp)

	def showTextSearch(self):
		self.showTextSearchEach( self.textSearch_text.get(), 'search_forward_tag', 'purple')
		self.showTextSearchEach( self.textSearchRevComp_text.get(), 'search_revComp_tag', 'green')

	def showTextSearchEach(self, pattern, search_tag, highlightColor):

		if pattern == "":   # no pattern
			return
		if len(pattern) <= 2:  # too short
			return

		start = 1.0
		first_flag = 0
		while 1:
			if self.caseSensitiveFlag.get() == 0: 
				pos = self.SeqTextWin_content.search(pattern, start, stopindex=END, nocase=1)
			else:
				pos = self.SeqTextWin_content.search(pattern, start, stopindex=END)
			if not pos:
				break
			print pos
			if first_flag == 0:   # move the window to the first match
				p_strs = split(pos, '.')
				p = int(p_strs[1])   # get the col 
				self.moveSeqTextWinContentPos(p)
				first_flag = 1
			for i in range( len(pattern) ):
				self.SeqTextWin_content.tag_add(search_tag, pos)
				pos = pos + "+1c"
			# move to the next position
			# start = pos + "+1c"
			start = pos

		# color
		self.SeqTextWin_content.tag_config(search_tag, background=highlightColor)
			
	def showTextSearchClear(self):
		self.SeqTextWin_content.tag_delete('search_forward_tag')
		self.SeqTextWin_content.tag_delete('search_revComp_tag')

  # ---------------------------------------------------

	def addDISTag(self, indexes, tagName, rowNum):

		if rowNum == self.numOfBars+2:  # don't touch the contig
			return
		for i in self.MM_info:        # scan through all the DIS
			myPos = "%d.%d" % (rowNum, i+self.seqNameCharSpace)
			if i in indexes:      # here is the mismatch
				self.SeqTextWin_content.tag_add(tagName, myPos)
			else:                 # this gene is good, the mismatch is at this column
				self.SeqTextWin_content.tag_add('spectator_tag', myPos)

  # ---------------------------------------------------

	def addInfoBinding(self, contigName, seqIndex, rowNum):
		size = self.seqNameCharSpace + self.sequences_data[seqIndex].getStart() + len(self.sequences_data[seqIndex].getSeqBody())
		for i in range(size):
			myPos = "%d.%d" % (rowNum, i)
			self.SeqTextWin_content.tag_add("showinfo_"+contigName, myPos)
		self.SeqTextWin_content.tag_bind("showinfo_"+contigName, '', "showinfo(contigName, contigName)" )

  # ---------------------------------------------------

	def saveAlignment(self):
		str = self.SeqTextWin_content.get("1.0", END)  # all the alignments
		filename = asksaveasfilename()    # save all those
		if filename != "":
			open(filename, 'w').write(str)

  # ---------------------------------------------------

	def generatePicture(self):

		# update the height of the image
		self.maxImageSizeY = (self.numOfBars) * (self.barHeight+self.vSpace) + \
			(self.hitnum)*(2*self.barHeight+self.vSpace*5) + self.vSpace + 20

		# setup up a new window and a new picture
		self.contigViewerWin = Toplevel()
		self.contigViewerWin.title("Viewer *" + self.contigName + "*")
		pic_h = self.maxImageSizeY + 100
		if pic_h > self.viewableSizeY + 100:
			pic_h = self.viewableSizeY + 100
		frame_1 = Frame(self.contigViewerWin)
		frame_1.pack(side = TOP, fill = BOTH, expand = True)
		self.pic = Canvas(frame_1, width=self.maxImageSizeX, height=pic_h, bg='black')
		self.pic.pack(side = LEFT, fill = BOTH, expand = True)

		# set up a scrollable bar
		vertical_scrollbar = Scrollbar(frame_1, orient=VERTICAL, command=self.pic.yview)
		vertical_scrollbar.pack(side = LEFT, fill = Y)
		vertical_scrollbar.width = 10
		self.pic.config(yscrollcommand=vertical_scrollbar.set)
		self.pic.config(scrollregion=(0,0,self.maxImageSizeX,self.maxImageSizeY + 120))

		# change the mouse icon for this canvas
		self.pic.config(cursor="crosshair")

		# plot it out ------------------------------------

		# draw the sub seqs
		seq_index = 0
		num_seq = len(self.sequences_data)
		for seq in self.sequences_data: # for each seq

			textcolor = 'white'     # pick text color for each seq

			### DEFINE FIRST Y POSITION ###
			posY = self.vSpace + seq_index * (self.vSpace+self.barHeight) + 10
			text_barHeight = posY+(self.barHeight*0.5)     # height for the text

			# decide seq bar color
			barcolor = 'lightblue'  # this is the initial color

			###############################################
			###  DEFINE COLORS FOR DIFFERENT GENOTYPES  ###
			###############################################

			######################################## CUSTOM SETTINGS FOR GENERIC PROJECT #
			#
			# FIRST TWO SYMBOLS FOR DIFFERENT GENOTYPES SHOULD BE "A_" or "B_" or "C_" or "D_"
			#       Type of Prefix 1
			###############################################################################

			if prefix_type == 1:

			############################################################
			##### MODIFY VARIABLES ACCORDING TO PARTICULAR PROJECT #####
			############################################################
			### TOMATO PROJECT ###
				if seq_index != num_seq-1:
					seq_type = (seq.getSeqName())[0:2]
					if seq_type == "A_":
						barcolor = 'lightblue'
					if seq_type == "B_":
						barcolor = 'yellow'
					if seq_type == "C_":
						barcolor = 'green'
					if seq_type == "D_":
						barcolor = 'orange'
				else:
					barcolor = 'red'
			########################################

			### CUSTOM SETTINGS FOR CGPDB PROJECT ###

			if prefix_type == 2:

				if seq_index != num_seq-1:
					seq_type = (seq.getSeqName())[2]
					if seq_type in "ABCDI":
						barcolor = 'orange'
					if seq_type in "EFGHJ":
						barcolor = 'green'
					if seq_type in "KL":
						barcolor = 'lightblue'
					if seq_type in "MN":
						barcolor = 'yellow'
				else:
					barcolor = 'red'

			if prefix_type == 3:

				if seq_index != num_seq-1:
					seq_type = (seq.getSeqName())[2]
					if seq_type in "ABCDI":
						barcolor = 'orange'
					if seq_type in "EFGHJ":
						barcolor = 'green'
					if seq_type in "KL":
						barcolor = 'lightblue'
					if seq_type in "MN":
						barcolor = 'yellow'
				else:
					barcolor = 'red'

			###########################################################################

			###### Prefix Type 4 (arabidopsis)

			if prefix_type == 4:

				if seq_index != num_seq-1:
					seq_type = (seq.getSeqName())[0:3]
					if seq_type == "P__":
						barcolor = 'lightblue'
					if seq_type == "Q__":
						barcolor = 'yellow'
					if seq_type == "R__":
						barcolor = 'green'
					if seq_type == "S__":
						barcolor = 'orange'
				else:
					barcolor = 'red'

			############################################################
			#####              END OF MODIFICATION                 #####
			############################################################

			if prefix_type == 0:

				print "Too Bad"
				exit

			###########################################################################

			# place the seq bar
			posX_start = self.hSpace + (seq.getStart()/self.maxGeneLen)*self.adjustedGraphChartSizeX
			posX_end = self.hSpace + (seq.getEnd()/self.maxGeneLen)*self.adjustedGraphChartSizeX
			posY_start = posY
			posY_end = posY_start + self.barHeight
			self.pic.create_rectangle(posX_start, posY_start, posX_end, posY_end, width=0, fill=barcolor)

			# place the mismatch segment
			self.displayMMError('D', seq.getD_info(), self.hSpace, self.maxGeneLen, \
				self.adjustedGraphChartSizeX, posY, self.barHeight, self.pic)
			self.displayMMError('I', seq.getI_info(), self.hSpace, self.maxGeneLen, \
				self.adjustedGraphChartSizeX, posY, self.barHeight, self.pic)
			self.displayMMError('S', seq.getS_info(), self.hSpace, self.maxGeneLen, \
				self.adjustedGraphChartSizeX, posY, self.barHeight, self.pic)
			self.displayMMError('XN', seq.getXN_info(), self.hSpace, self.maxGeneLen, \
				self.adjustedGraphChartSizeX, posY, self.barHeight, self.pic)

			# place the start index
			start = seq.getStart()
			### DEFINE START POSITION ###
			posX = self.hSpace + (start/self.maxGeneLen)*self.adjustedGraphChartSizeX
			self.pic.create_text(posX-15, text_barHeight, text=str(start), fill=textcolor)

			# place the end index
			end = seq.getEnd()
			# the extra space is used to sparate the bar and the text
			###  DEFINE END POSITION  ###
			posX = self.hSpace + (end/self.maxGeneLen)*self.adjustedGraphChartSizeX
			self.GC_Box_X_end = posX
			self.pic.create_text(posX+12, text_barHeight, text=str(end), fill=textcolor)

			# place the sub seq name
			posX = self.hSpace + self.adjustedGraphChartSizeX + self.hSpace*2
			seqName = seq.getSeqName()
			self.pic.create_text(posX-20, text_barHeight, text=seqName, fill=textcolor, anchor=W)

			# increment the seq index
			seq_index = seq_index + 1
			self.pic.update()

		# enable mouse interaction
		self.pic.bind('', self.onLeftClick)
		self.pic.bind('', self.onMiddleClick)
		self.pic.bind('', self.onMiddleClick)
		self.pic.bind('', self.onRightClick)
		self.pic.bind('', self.onShiftLeftClick)
		self.pic.bind('', self.onShiftRightClick)

		# draw the GC content chart
		self.generatePictureGCContent(posY + 20)

		# save the contig Y location
		self.posY_contig = posY
		# draw the blast result
		posY = self.vSpace*2 + seq_index * (self.vSpace+self.barHeight)
		posY += 5
		for hitnum_i in range( self.hitnum ):
			status = self.setupBlastResultGlobalVar(hitnum_i)
			if status != "good":
				print "blast result error: No hits found"
				break
			self.generatePictureBlastResultOverlap(posY+120)
			posY += (2*self.barHeight+self.vSpace*5)

  # ---------------------------------------------------

	def generatePictureGCContent(self, posY):

		baseY = posY + self.GCContentSizeY - 2    # the baseline Y coordinate
		borderColor = 'gray'
		backgroundColor = 'black'
		slidingWindowSize = 20   # how many we are analyzing at a time
		stepSize = 3     # step size (how far we jump to the next)

		# draw a box
		posX_start = self.hSpace / 2
		posX_end = self.GC_Box_X_end
		# posX_end = self.hSpace*3 + (self.graphChartSizeX/self.maxGeneLen)*self.adjustedGraphChartSizeX
		posY_start = posY
		posY_end = posY_start + self.GCContentSizeY
		self.pic.create_rectangle(posX_start, posY_start, posX_end, posY_end, width=0, fill=borderColor)
		self.pic.create_rectangle(posX_start+1, posY_start+1, posX_end-1, posY_end-1, width=0, fill=backgroundColor)
		self.pic.create_text(posX_start+20, posY_start+20, text="GC% content", fill='white', anchor=W)

		# find GC content
		seq = self.sequences_data[self.contigIndex].getSeqBody()
		index_s = 0
		while index_s + slidingWindowSize < len(seq):
			index_e = index_s + slidingWindowSize
			GCContent = seq[index_s:index_e]
			# count number of G's and C's
			numOfGC = 0
			for ch in GCContent:
				if ch == 'G' or ch == 'C' or ch == 'q' or ch == 'c':
					numOfGC += 1
			if GCContent == 0:
				index_s += stepSize
				continue
			percentage = (numOfGC*1.0) / slidingWindowSize
			#print GCContent + str(numOfGC)
			# draw bar
			index_middle = (index_e+index_s)/2
			index_middle_left = index_middle - stepSize/2.0
			index_middle_right = index_middle + stepSize/2.0
			posX_start = self.hSpace + (index_middle_left/self.maxGeneLen)*self.adjustedGraphChartSizeX
			posX_end = self.hSpace + (index_middle_right/self.maxGeneLen)*self.adjustedGraphChartSizeX
			posY_start = baseY
			posY_end = posY_start - percentage*self.GCContentSizeY
			barColor = self.getBarColor(percentage)
			self.pic.create_rectangle(posX_start, posY_start, posX_end, posY_end, width=0, fill=barColor)
			self.pic.update()
			# update index_s
			index_s += stepSize

	def getBarColor(self, percentage):
		hexR = int( 16*percentage)
		# hexG = int( 0.0 )
		hexG = int( 8*(1-percentage))
		hexB = int( 16*(1-percentage))
		return '#' + self.int2Hex(hexR) + self.int2Hex(hexG) + self.int2Hex(hexB)

	def int2Hex(self, i):
		if i < 0:
			return str('0')
		if i >= 0 and i <= 9:
			return str(i)
		if i >= 10 and i <= 15:
			return chr( ord('A') + (i-10) )
		if i >= 16:
			return str('F')

  # ---------------------------------------------------

	def getConsecutiveInfo(self, numList):
		if len(numList) < 2:   # if not much num, just quit
			return numList
		r_l = []   # condensed resulted list
		NaN = -9999999
		firstNum = NaN         # first index
		lastNum = NaN          # the previous index
		count = 0
		for num in numList:
			# this handles the first index, then jump to the next
			if count == 0:    # set the first index
				firstNum = num
				lastNum = num
				count = 1
				continue
			# this is basically the else case, for the next index
			if lastNum == num - 1:
				count += 1
				lastNum = num
			else:
				# append the old info
				info = [firstNum, count]
				r_l.append(info)
				# save the new info
				firstNum = num
				lastNum = num
				count = 1

		# append the old info
		info = [firstNum, count]
		r_l.append(info)

		return r_l


	def setupBlastResultGlobalVar(self, index):

		print ">>>>>>>>>>>>>>>>>>>>>>>>>---------------------------"
		print "TIGR index: " + str(index)
		try:
			[infoData, posData] = self.blastResult[index]
			[hitNum, gapListC, gapListT] = self.gapInfo[index]
		except:
			return "error"
		self.subjectID = infoData[0]
		self.query_first = infoData[1]
		self.query_last = infoData[2]
		self.subject_first = infoData[3]
		self.subject_last = infoData[4]
		self.len_q = infoData[5]
		self.len_s = infoData[6]
		print "infoData: " + str(infoData)
		print "posData: " + str(posData)
		self.gapListC = self.getConsecutiveInfo(gapListC)    # contig gap info
		self.gapListT = gapListT    # tigr gap info
		print "gapListC: " + str(gapListC)
		print "gapListT: " + str(gapListT)

		# change direction
		self.dir_bottom_bar = "F"
		if self.query_first > self.query_last:
			self.dir_bottom_bar = "R"
		if posData[0] == "forward":
			self.dir_top_bar = "F"
		else:
			self.dir_top_bar = "R"

		# store exons info
		positions = posData[1]
		exons_raw = split(positions, "|")
		self.introns = []
		self.exons = []
		for exon_raw in exons_raw:
			index1_str, index2_str = split(exon_raw, "-")
			index1, index2 = int(index1_str), int(index2_str)
			if self.dir_top_bar == "F":
				self.exons.append( [index1, index2] )
			elif self.dir_top_bar == "R":
				self.exons.append( [index2, index1] )
		if self.dir_top_bar == "R":
			self.exons.reverse()
		# store introns info
		if len(self.exons) > 1:
			numExons = len(self.exons)
			for ei in range(numExons-1):
				left_pair = self.exons[ei]
				right_pair = self.exons[ei+1]
				left = left_pair[1]
				right = right_pair[0]
				### CORRECTION BY 1 NUCLEOTIDE ###
				# intron_size = right - left
				intron_size = right - left - 1
				self.introns.append( intron_size )

		return "good"

  # ---------------------------------------------------

	def BlastResult_placeStartEndIndexes(self, start, end, start_str, end_str, posY, textcolor):
		# place the start index
		textcolor = 'cyan'
		if self.dir_top_bar == "F":
			### START INDEX ###
			posX = self.hSpace + (atof(start_str)/self.maxGeneLen)*self.adjustedGraphChartSizeX
			self.pic.create_text(posX-20, posY+self.barHeight*1.5, text=(str(start_str)+" nt"), fill=textcolor)
			###  END INDEX  ###
			posX = self.hSpace + (atof(end_str)/self.maxGeneLen)*self.adjustedGraphChartSizeX
			self.pic.create_text(posX+25, posY+self.barHeight*1.5, text=(str(end_str)+" nt"), fill=textcolor)
		if self.dir_top_bar == "R":
			### START INDEX ###
			posX = self.hSpace + (atof(start_str)/self.maxGeneLen)*self.adjustedGraphChartSizeX
			self.pic.create_text(posX-20, posY+self.barHeight*1.5, text=(str(start_str)+" nt"), fill=textcolor)
			###  END INDEX  ###
			posX = self.hSpace + (atof(end_str)/self.maxGeneLen)*self.adjustedGraphChartSizeX
			self.pic.create_text(posX+25, posY+self.barHeight*1.5, text=(str(end_str)+" nt"), fill=textcolor)


  # ---------------------------------------------------

	def generatePictureBlastResultOverlap(self, posY=0):

		#########################################################################
		### THIS IS A MOST IMPORTANT AND COMPLEX/COMPLICATED FUNCTION         ###
		### SOME CALCULATION OF COORDINATES MAY LOOK REALLY CONFUSING         ###
		### GAPS ON BLAST ALIGNMENT DO NOT ALLOW TO DISPLAY INTRONS PERFECTLY ###
		###                                                                   ###
		### THE PROBLEM IS THAT THE LENGTH OF BLAST ALIGNMENT DOES NOT CORRESPOND
		### TO THE LENGTHS OF ORIGINAL SEQUENCES. IT MAY BE LONGER BUT WE DISPLAY
		### ITS LENTH ACCORDING TO CONTIG (EST) LENGTH                        ###
		#########################################################################

		# constants
		end = float(self.len_s)
		totalLen = (self.graphChartSizeX*1.0)
		totalLen2 = (self.graphChartSizeX*1.0/self.maxGeneLen)*(end)
		textcolor = 'white' # pick text color for each seq
		text_barHeight = self.barHeight   # height for the text

		# decide start and end indexes
		### TOP BAR - SUBJECT (ARABIDOPSIS) ###
		### BOTTOM BAR - QUERY (EST CONTIG) ###
		if self.dir_top_bar == "F":
			start = self.subject_first * 1.0
			end = self.subject_last * 1.0
		else:
			end = self.subject_first * 1.0
			start = self.subject_last * 1.0
		if self.dir_bottom_bar == "F":
			start_str = self.query_first
			end_str = self.query_last
		else:
			end_str = self.query_first
			start_str = self.query_last

		# place the start and end indexes
		self.BlastResult_placeStartEndIndexes(start, end, start_str, end_str, posY, textcolor)

		###  DRAW BLAST HITS  ###
		# place the shorter seq bar
		barcolor = 'lightgreen'
		start = atof(start_str) * 1.0
		end = atof(end_str) * 1.0
		### ARABIDOPSIS HIT START ###
		posX_start = self.hSpace + (start/self.maxGeneLen)*self.adjustedGraphChartSizeX
		###  ARABIDOPSIS HIT END  ###
		posX_end = self.hSpace + (end/self.maxGeneLen)*self.adjustedGraphChartSizeX
		###      Y POSITIONS      ###
		posY_start = posY
		posY_end = posY_start + self.barHeight
		### DRAW THE BLAST HIT BAR ###
		self.pic.create_rectangle(posX_start, posY_start, posX_end, posY_end, width=0, fill=barcolor)


		# put introns and exons ------------------------

		# take off the extrons on the left
		exon_lens = []
		exon_p_list = []
		curr_pos = 0
		### START - END POSITIONS TO DISPLAY INTRONS - EXONS ###
		### MULTIPLY BY 3: PROTEIN LENGTH --> DNA LENGTH
		# start = self.subject_first * 3
		### START CORRECTION BY 2 NUCLEOTIDES ###
		start = self.subject_first * 3 - 2
		end = self.subject_last * 3 
		########################################################
		first_flag = 0
		skip_num = 0
		included_num_list = []
		print "start: " + str(start)
		print "end: " + str(end)
		for exon_pair_i in range( len(self.exons) ):
			exon_pair = self.exons[exon_pair_i]
			### EXON LENGTH CALCULATION ###
			# diff = int( fabs(exon_pair[1] - exon_pair[0]) )
			### CORRECTION BY 1 NUCLEOTIDE ###
			diff = int( fabs(exon_pair[1] - exon_pair[0]) + 1)
			### ? IS IT OK ? ###
			### curr_pos += diff + 1
			curr_pos += diff
			print "curr_pos: " + str(curr_pos)
			if curr_pos < start:
				skip_num += 1
				continue
			elif curr_pos > end:
				if first_flag == 0:
					break
				last_pos = curr_pos - diff
				print "end: " + str(end)
				print "curr_pos: " + str(curr_pos)
				print "diff: " + str(diff)
				print "last_pos: " + str(last_pos)
				exon_p = last_pos + (end-last_pos)/2.0 - start
				print "exon_p: " + str(exon_p)
				exon_p_list.append(exon_p)
				exon_lens.append(end-last_pos)
				break
			else:
				# deal with the first time entry
				if first_flag == 0:
					exon_p = (curr_pos-start)/2.0
					exon_p_list.append(exon_p)
					exon_lens.append(curr_pos-start)
					included_num_list.append( exon_pair_i )
					first_flag = 1
					continue
				exon_p = (curr_pos-start) - diff/2.0
				exon_p_list.append(exon_p)
				exon_lens.append(diff)
				included_num_list.append( exon_pair_i )
		print "exon lens: " + str(exon_lens)
		print "exon p_list: " + str(exon_p_list)

		# take off the introns on the left
		intron_lens = []
		print self.exons
		print included_num_list
		print self.introns
		for included_i in included_num_list:
			intron_lens.append( self.introns[included_i] )
			
		print "intron lens: " + str(intron_lens)

		#== place exons
		if len(exon_lens) > 1:
			for exon_i in range( len(exon_lens) ):
				if self.dir_bottom_bar == "F":
					exon_l = exon_lens[exon_i]
					exon_p = exon_p_list[exon_i] * 1.0
					start = atof(start_str) * 1.0
					start = (start/self.maxGeneLen)*self.adjustedGraphChartSizeX
					exon_p = (exon_p/self.maxGeneLen)*self.adjustedGraphChartSizeX
					### FORWARD COUNTING ###
					posX = self.hSpace + start + exon_p
					self.pic.create_text(posX, posY+text_barHeight+self.barHeight*0.5+1, text=str(exon_l), fill='yellow')
				if self.dir_bottom_bar == "R":
					exon_l = exon_lens[exon_i]
					exon_p = exon_p_list[exon_i] * 1.0
					start = atof(start_str) * 1.0
					start = (start/self.maxGeneLen)*self.adjustedGraphChartSizeX
					end_adj = (end_str/self.maxGeneLen)*self.adjustedGraphChartSizeX
					exon_p = (exon_p/self.maxGeneLen)*self.adjustedGraphChartSizeX
					### REVERSE COUNTING ###
					posX = end_adj + self.hSpace - exon_p
					self.pic.create_text(posX, posY+text_barHeight+self.barHeight*0.5+1, text=str(exon_l), fill='yellow')

		#== place introns
		#-- place vertical lines
		intronLineColor = "red"
		curr_pos = 0
		for intron_i in range( len(intron_lens) ):
			if self.dir_bottom_bar == "F":
				pos = curr_pos + exon_lens[intron_i] * 1.0
				start = atof(start_str) * 1.0
				# INTRON POSITION
				start = (start/self.maxGeneLen)*self.adjustedGraphChartSizeX
				pos = (pos/self.maxGeneLen)*self.adjustedGraphChartSizeX
				posX_start = self.hSpace + start + pos
				posX_end = posX_start + 1
				posY_start = posY
				posY_end = posY_start + self.barHeight
				self.pic.create_rectangle(posX_start, posY_start, posX_end, posY_end, width=0, fill=intronLineColor)
				# draw triangle
				triangle_size = 10
				posX1 = posX_start
				posY1 = posY_end
				posX2 = posX1 - triangle_size
				posY2 = posY1 + triangle_size
				posX3 = posX1 + triangle_size
				posY3 = posY1 + triangle_size
				self.pic.create_line(posX1, posY1, posX2, posY2, fill=intronLineColor)
				self.pic.create_line(posX1, posY1, posX3, posY3, fill=intronLineColor)
				self.pic.create_line(posX2, posY2, posX3, posY3, fill=intronLineColor)
				# place intron value
				intron_val = intron_lens[intron_i]
				posX = posX_start
				self.pic.create_text(posX, posY+text_barHeight+self.barHeight*0.5+triangle_size+2, \
					text=str(intron_val), fill=textcolor)

				# place intron index
				intron_index = skip_num + intron_i + 1
				intron_index_str = "[" + str(intron_index) + "]"
				posX = posX_start
				self.pic.create_text(posX, posY+2*text_barHeight+self.barHeight*0.5+triangle_size+3, \
					text=intron_index_str, fill=textcolor)

				# update curr pos
				curr_pos += exon_lens[intron_i] * 1.0

			if self.dir_bottom_bar == "R":
				pos = curr_pos + exon_lens[intron_i] * 1.0
				start = atof(start_str) * 1.0
				# INTRON POSITION
				start = (start/self.maxGeneLen)*self.adjustedGraphChartSizeX
				end_adj = (end_str/self.maxGeneLen)*self.adjustedGraphChartSizeX
				pos = (pos/self.maxGeneLen)*self.adjustedGraphChartSizeX
				# COUNT FROM THE END
				posX_start = self.hSpace + end_adj - pos
				posX_end = posX_start+1
				posY_start = posY
				posY_end = posY_start + self.barHeight
				self.pic.create_rectangle(posX_start, posY_start, posX_end, posY_end, width=0, fill=intronLineColor)
				# draw triangle
				triangle_size = 10
				posX1 = posX_start
				posY1 = posY_end
				posX2 = posX1 - triangle_size
				posY2 = posY1 + triangle_size
				posX3 = posX1 + triangle_size
				posY3 = posY1 + triangle_size
				self.pic.create_line(posX1, posY1, posX2, posY2, fill=intronLineColor)
				self.pic.create_line(posX1, posY1, posX3, posY3, fill=intronLineColor)
				self.pic.create_line(posX2, posY2, posX3, posY3, fill=intronLineColor)
				# place intron value
				intron_val = intron_lens[intron_i]
				posX = posX_start
				self.pic.create_text(posX, posY+text_barHeight+self.barHeight*0.5+triangle_size+2, \
					text=str(intron_val), fill=textcolor)

				# place intron index
				intron_index = skip_num + intron_i + 1
				intron_index_str = "[" + str(intron_index) + "]"
				posX = posX_start
				self.pic.create_text(posX, posY+2*text_barHeight+self.barHeight*0.5+triangle_size+3, \
					text=intron_index_str, fill=textcolor)

				# update curr pos
				curr_pos += exon_lens[intron_i] * 1.0

		# place tigr gap lines at tigr
		### GAPS ON ARABIDOPSIS ###
		gap_tt_color = "blue"
		for t_pos in self.gapListT:
			start = atof(start_str) * 1.0
			posX_start = self.hSpace + ((start+t_pos)/self.maxGeneLen)*self.adjustedGraphChartSizeX
			print "gap pos start: " + str(posX_start)
			posX_end = posX_start
			posY_start = posY
			posY_end = posY_start + self.barHeight
			self.pic.create_rectangle(posX_start, posY_start, posX_end, posY_end, width=0, fill=gap_tt_color)

		# place contig gap lines at tigr
		### GAPS ON CONTIG CONSENSUS ###
		gap_ct_color = "orange"

		actual_align_length = 0

		for c_info in self.gapListC:
			[c_pos, c_len] = c_info
			start = atof(start_str) * 1.0
			posX_start = self.hSpace + ((start+c_pos)/self.maxGeneLen)*self.adjustedGraphChartSizeX
			print "gap pos start: " + str(posX_start)
			posX_end = posX_start
			posY_start = posY
			posY_end = posY_start + self.barHeight
			self.pic.create_rectangle(posX_start, posY_start, posX_end, posY_end, width=0, fill=gap_ct_color)
			# draw triangle
			triangle_size = 10
			posX1 = posX_start
			posY1 = posY_start
			posX2 = posX1 - triangle_size
			posY2 = posY1 - triangle_size
			posX3 = posX1 + triangle_size
			posY3 = posY1 - triangle_size
			self.pic.create_line(posX1, posY1, posX2, posY2, fill=gap_ct_color)
			self.pic.create_line(posX1, posY1, posX3, posY3, fill=gap_ct_color)
			self.pic.create_line(posX2, posY2, posX3, posY3, fill=gap_ct_color)
			# place gap value
			posX = posX_start
			self.pic.create_text(posX, posY-text_barHeight-triangle_size+3, text=str(c_len), fill='green')
			### INCR BLAST ALIGNMENT ###
			actual_align_length = actual_align_length + c_len
			print actual_align_length
			# draw gap line on the contig line
			posX_contig_start = posX_start
			posX_contig_end = posX_contig_start
			posY_contig_start = self.posY_contig
			posY_contig_end = posY_contig_start + self.barHeight
			self.pic.create_rectangle(posX_contig_start, posY_contig_start, \
				posX_contig_end, posY_contig_end, width=0, fill=gap_ct_color)

		### CREATE MARK FOR ACTUAL LENGTH OF BLAST ALIGNMENT ###
		# ???????????????????????????????????????????????????? #
		########################################################

		aln_end = atof(end_str) * 1.0
		alignX_end = self.hSpace + ((aln_end + actual_align_length)/self.maxGeneLen)*self.adjustedGraphChartSizeX
		self.pic.create_rectangle(alignX_end-1, posY_start, alignX_end+1, posY_end, width=0, fill='pink')

		# place tigr seq id
		### ARABIDOPSIS ID ###
		posX = self.hSpace*2.5 + self.graphChartSizeX
		self.pic.create_text(posX-60, posY+10, text=str(self.subjectID), fill='gold')
		self.pic.update()

  # ---------------------------------------------------

	def moveSeqTextWinContent(self, event):
		x = event.x - self.hSpace
		fraction = (x+20)/(self.graphChartSizeX * 1.0)
		self.moveSeqTextWinContentFraction(fraction)

	def moveSeqTextWinContentPos(self, pos):
		fraction = (pos-20)/(self.maxGeneLen * 1.0)
		self.moveSeqTextWinContentFraction(fraction)

	def moveSeqTextWinContentFraction(self, fraction):
		if fraction < 0:
			fraction = 0
		if fraction > 1:
			fraction = 1
		if self.SeqTextWin_open == 0:    # if text win not open, open it
			self.generateSeqTextWin()
		# move the text to the location of interest
		self.SeqTextWin_content.xview(MOVETO, fraction)

  # ---------------------------------------------------

	def highlightTextWinGenes(self):
		L_str = self.CVLTR_L_text.get()        # left index
		LX_str = self.CVLTR_LX_text.get()      # left excluded index
		R_str = self.CVLTR_R_text.get()        # right index
		RX_str = self.CVLTR_RX_text.get()      # right excluded index
		doLeftFlag = 1   # indicate we should highlight the left one
		doRightFlag = 1   # indicate we should highlight the right one
		if L_str == "" or LX_str == "":   # no input yet, so quit
			doLeftFlag = 0
		if R_str == "" or RX_str == "":   # no input yet, so quit
			doRightFlag = 0
		# clear the old background color
		self.SeqTextWin_content.tag_delete('interested_tag')
		# draw the new background color
		if doLeftFlag == 1:
			L = int(L_str) + self.seqNameCharSpace
			LX = int(LX_str) + self.seqNameCharSpace
			for i in range(1, self.numOfBars+1):
				startingPos = "%d.%d" % (i, LX)
				endingPos = "%d.%d" % (i, L)
				self.SeqTextWin_content.tag_add('interested_tag', startingPos, endingPos)
		if doRightFlag == 1:
			R = int(R_str) + self.seqNameCharSpace
			RX = int(RX_str) + self.seqNameCharSpace
			for i in range(1, self.numOfBars+1):
				startingPos = "%d.%d" % (i, R)
				endingPos = "%d.%d" % (i, RX)
				self.SeqTextWin_content.tag_add('interested_tag', startingPos, endingPos)
		self.SeqTextWin_content.tag_config('interested_tag', background='yellow')

  # ---------------------------------------------------

	def drawLeftBox(self):
		L_str = self.CVLTR_L_text.get()        # left index
		LX_str = self.CVLTR_LX_text.get()      # left excluded index
		if L_str == "" or LX_str == "":   # no input yet, so quit
			return
		L = int(L_str)
		LX = int(LX_str)

		# draw the box
		x0 = self.convert_seqPos_to_pixelPos(LX)
		x1 = self.convert_seqPos_to_pixelPos(L)
		self.drawBox(x0, x1, "boxL")

  # ---------------------------------------------------

	def drawRightBox(self):
		R_str = self.CVLTR_R_text.get()        # right index
		RX_str = self.CVLTR_RX_text.get()      # right excluded index
		if R_str == "" or RX_str == "":   # no input yet, so quit
			return
		R = int(R_str)
		RX = int(RX_str)

		# draw the box
		x0 = self.convert_seqPos_to_pixelPos(R)
		x1 = self.convert_seqPos_to_pixelPos(RX)
		self.drawBox(x0, x1, "boxR")

  # ---------------------------------------------------

	def drawBox(self, x0, x1, tag):
		self.pic.delete(tag)
		y0 = self.vSpace / 2
		y1 = self.maxImageSizeY - (self.vSpace/2) + 100
		if x0 < x1 and y0 < y1:    # valid case
			if x1-x0 >= 30:    # recommended case, box is big enough
				self.pic.create_rectangle(x0, y0, x1, y1, tags=tag, outline='white', width=1)
			else:     # box is small, so display in different color
				self.pic.create_rectangle(x0, y0, x1, y1, tags=tag, outline='yellow', width=2)

  # ---------------------------------------------------

	def onShiftLeftClick(self, event):
		if self.CVLTRWin_open == 0: # if not already open
			self.showContigLTRWin(event) # open a new win
		self.CVLTR_fill_in_left_excluded_index(event)
		self.moveSeqTextWinContent(event) # move the text
		self.highlightTextWinGenes() # highlight the corresponding genes
		self.drawLeftBox() # draw the rectangle

  # ---------------------------------------------------

	def onShiftRightClick(self, event):
		if self.CVLTRWin_open == 0: # if not already open
			self.showContigLTRWin(event) # open a new win
		self.CVLTR_fill_in_right_excluded_index(event)
		self.moveSeqTextWinContent(event) # move the text
		self.highlightTextWinGenes() # highlight the corresponding genes
		self.drawRightBox() # draw the rectangle

  # ---------------------------------------------------

	def onLeftClick(self, event):
		if self.CVLTRWin_open == 0: # if not already open
			self.showContigLTRWin(event) # open a new win
		self.CVLTR_fill_in_left_index(event)
		self.moveSeqTextWinContent(event) # move the text
		self.highlightTextWinGenes() # highlight the corresponding genes
		self.updateLength() # update LR difference
		self.drawLeftBox() # draw the rectangle

  # ---------------------------------------------------

	def onMiddleClick(self, event):
		if self.CVLTRWin_open == 0: # if not already open
			self.showContigLTRWin(event) # open a new win
		self.CVLTR_fill_in_middle_index(event)
		self.moveSeqTextWinContent(event) # move the text
		self.highlightTextWinGenes() # highlight the corresponding genes

  # ---------------------------------------------------

	def onRightClick(self, event):
		if self.CVLTRWin_open == 0: # if not already open
			self.showContigLTRWin(event) # open a new win
		self.CVLTR_fill_in_right_index(event)
		self.moveSeqTextWinContent(event) # move the text
		self.highlightTextWinGenes() # highlight the corresponding genes
		self.updateLength() # update LR difference
		self.drawRightBox() # draw the rectangle

  # ---------------------------------------------------

	def SeqTextWinDestroy(self, event):
		self.SeqTextWin_open = 0 # indicate close

  # ---------------------------------------------------

	def LTRWinDestroy(self, event):
		self.CVLTRWin_open = 0 # indicate close

  # ---------------------------------------------------

	def interestListWinDestroy(self, event):
		global g_interestListWin_open
		g_interestListWin_open = 0 # indicate close

  # ---------------------------------------------------

	def showContigLTRWin(self, event):

		# setup up a new window and some components
		self.contigViewerLTRWin = Toplevel()
		self.contigViewerLTRWin.title("Indexes *" + self.contigName + "*")
		self.CVLTRWin_open = 1 # indicate open
		self.contigViewerLTRWin.bind('', self.LTRWinDestroy)

		frame_1 = Frame(self.contigViewerLTRWin)
		frame_1.pack(side = TOP, fill = BOTH, expand = True)

		# contig name label and entry
		self.CVLTR_cID_label = Label(frame_1, text="Contig ID:")
		self.CVLTR_cID_label.pack( side=LEFT, padx = 5)
		self.CVLTR_cID_text = Entry(frame_1, name="contigID_text", width=20)
		self.CVLTR_cID_text.pack( side=LEFT, padx = 5)

		# left index label and entry
		self.CVLTR_L_label = Label(frame_1, text="L")
		self.CVLTR_L_label.pack( side=LEFT, padx = 5)
		self.CVLTR_L_text = Entry(frame_1, name="l_text", width=5)
		self.CVLTR_L_text.pack( side=LEFT, padx = 5)

		# middle index label and entry
		self.CVLTR_M_label = Label(frame_1, text="M")
		self.CVLTR_M_label.pack( side=LEFT, padx = 5)
		self.CVLTR_M_text = Entry(frame_1, name="m_text", width=5)
		self.CVLTR_M_text.pack( side=LEFT, padx = 5)

		# right index label and entry
		self.CVLTR_R_label = Label(frame_1, text="R")
		self.CVLTR_R_label.pack( side=LEFT, padx = 5)
		self.CVLTR_R_text = Entry(frame_1, name="r_text", width=5)
		self.CVLTR_R_text.pack( side=LEFT, padx = 5)

		# length label and entry (R-L)
		self.CVLTR_length_label = Label(frame_1, text="length")
		self.CVLTR_length_label.pack( side=LEFT, padx = 5)
		self.CVLTR_length_text = Entry(frame_1, name="length_text", width=5)
		self.CVLTR_length_text.pack( side=LEFT, padx = 5)

		# left excluded index label and entry
		self.CVLTR_LX_label = Label(frame_1, text="LX")
		self.CVLTR_LX_label.pack( side=LEFT, padx = 5)
		self.CVLTR_LX_text = Entry(frame_1, name="lx_text", width=5)
		self.CVLTR_LX_text.pack( side=LEFT, padx = 5)

		# right excluded index label and entry
		self.CVLTR_RX_label = Label(frame_1, text="RX")
		self.CVLTR_RX_label.pack( side=LEFT, padx = 5)
		self.CVLTR_RX_text = Entry(frame_1, name="rx_text", width=5)
		self.CVLTR_RX_text.pack( side=LEFT, padx = 5)

		# length of the contig (constant)
		self.CVLTR_contigLength_label = Label(frame_1, text="Contig Length")
		self.CVLTR_contigLength_label.pack( side=LEFT, padx = 5)
		self.CVLTR_contigLength_text = Entry(frame_1, name="contigLength_text", width=5)
		self.CVLTR_contigLength_text.pack( side=LEFT, padx = 5)

		frame_2 = Frame(self.contigViewerLTRWin)
		frame_2.pack(side = TOP, fill = BOTH, expand = True)

		# reset button
		self.CVLTR_reset_button = Button(frame_2, text="Reset", command=self.CVLTR_resetIndexes)
		self.CVLTR_reset_button.pack(side=RIGHT, padx = 5)

		# add to interest list button
		self.CVLTR_addToInterestList_button = Button(frame_2, text="Add to list", command=self.addToInterestList)
		self.CVLTR_addToInterestList_button.pack(side=RIGHT, padx = 5)

		# generate file for PerlPrimer program
		self.CVLTR_PerlPrimer_button = Button(frame_2, text="PerlPrimer", command=self.addToPerlPrimer)
		self.CVLTR_PerlPrimer_button.pack(side=RIGHT, padx = 5)

		# fill in the contig name and contig length
		self.CVLTR_fill_in_ContigName_and_contigLength(event)

  # ---------------------------------------------------

	def addToPerlPrimer(self):

		global g_use_singleton
		global g_seqNameCharSpace

		if g_use_singleton == "FALSE":
			singleton_flag = 0
		if g_use_singleton == "TRUE":
			singleton_flag = 1

		cont_id = self.CVLTR_cID_text.get()
		excl5B  = self.CVLTR_L_text.get()
		# self.CVLTR_M_text.get()
		excl3A  = self.CVLTR_R_text.get()
		# self.CVLTR_length_text.get()
		excl5A  = self.CVLTR_LX_text.get()
		excl3B  = self.CVLTR_RX_text.get()
		# self.CVLTR_contigLength_text.get()

		print cont_id + '\t' + excl5A + '\t' + excl5B + '\t' + excl3A + '\t' + excl3B + '\n'

		start = 1.0
		if singleton_flag == 0:
			# pattern = "Contig"
			pattern = "------------------------------------------------------------"
		if singleton_flag == 1:
			pattern = "------------------------------------------------------------"

		find_me = self.SeqTextWin_content.search(pattern, start, stopindex=END)

		seq = self.SeqTextWin_content.get(find_me, END)
		atgc = seq
		atgc_clean = ""
		for t in atgc:
			n = t
			if t == '-':
				n = ''
			if t == '\n':
				n = ''
			atgc_clean += n
		# print seq
		# print atgc
		atgc_clean = atgc_clean[g_seqNameCharSpace:]
		print atgc_clean + '\n'

		filename = asksaveasfilename() # save all those
		open(filename, 'w').write(">" + cont_id + " 5prime_region[" + excl5A + "-" + excl5B + "]" \
						+ " 3prime_region[" + excl3A + "-" + excl3B + "]" \
						+ " page[1] " + '\n' + atgc_clean + '\n')

  # ---------------------------------------------------

	def showInterestListWin(self):

		global g_interestListWin
		global g_interestListWin_open
		global g_interestListIndex
		global g_interestList_content

		# setup up a new window and some components
		g_interestListWin = Toplevel()
		g_interestListWin.title("Interest List")
		g_interestListWin.geometry("500x200")
		g_interestListWin_open = 1   # indicate open
		g_interestListIndex = 1      # beginning row location for insertion
		g_interestListWin.bind('', self.interestListWinDestroy)
		g_interestListWin.resizable(height=True, width=True)

		# set up textarea
		frame_1 = Frame(g_interestListWin)
		frame_1.pack(side = TOP, fill = BOTH, expand = True)
		g_interestList_content = Text(frame_1, height=2, width=10, wrap=NONE)
		g_interestList_content.pack(side = LEFT, fill = BOTH, expand = True)

		# set up scrollable bars
		vertical_scrollbar = Scrollbar(frame_1, orient=VERTICAL, command=g_interestList_content.yview)
		vertical_scrollbar.pack(side = LEFT, fill = Y)

		frame_2 = Frame(g_interestListWin)
		frame_2.pack(side = TOP, fill = X)
		horizontal_scrollbar = Scrollbar(frame_2, orient=HORIZONTAL, command=g_interestList_content.xview)
		horizontal_scrollbar.pack(fill = X)
		g_interestList_content.config(xscrollcommand=horizontal_scrollbar.set)
		g_interestList_content.config(yscrollcommand=vertical_scrollbar.set)

		# save alignment button
		frame_3 = Frame(g_interestListWin)
		frame_3.pack(side = TOP, fill = X)
		saveInterestListButton = Button(frame_3, text="Save as file", command=self.saveInterestList)
		saveInterestListButton.pack()

  # ---------------------------------------------------

	def addToInterestList(self):

		global g_interestListWin
		global g_interestListWin_open
		global g_interestListIndex
		global g_interestList_content

		if g_interestListWin_open == 0: # if not already open
			self.showInterestListWin() # open a new win

		# construct the string
		sep = " "
		str = ""
		str = str + self.CVLTR_cID_text.get() + sep
		str = str + self.CVLTR_L_text.get() + sep
		str = str + self.CVLTR_M_text.get() + sep
		str = str + self.CVLTR_R_text.get() + sep
		str = str + self.CVLTR_length_text.get() + sep
		str = str + self.CVLTR_LX_text.get() + sep
		str = str + self.CVLTR_RX_text.get() + sep
		str = str + self.CVLTR_contigLength_text.get()

		# insert the text into the interest text win
		myPos = "%s.0" % (g_interestListIndex)
		g_interestList_content.insert(myPos, str+"\n")
		g_interestListIndex = g_interestListIndex + 1

		# move the textarea downward if there are too many
		if g_interestListIndex > 4:
			g_interestList_content.yview(SCROLL, 1, UNITS)

  # ---------------------------------------------------

	def saveInterestList(self):

		global g_interestListWin
		global g_interestListWin_open
		global g_interestListIndex
		global g_interestList_content

		str = g_interestList_content.get("1.0", END) # all the interesting indexes
		filename = asksaveasfilename() # save all those
		open(filename, 'w').write(str)

  # ---------------------------------------------------

	def updateLength(self): # update LR difference
		if self.CVLTR_L_text.get() == "" or self.CVLTR_R_text.get() == "":
			return    # quit if data not ready
		self.CVLTR_length_text.delete(0, END) # clear it first
		left = int( self.CVLTR_L_text.get() )
		right = int( self.CVLTR_R_text.get() )
		diff = right - left
		self.CVLTR_length_text.insert(0, str(diff)) # fill it in

  # ---------------------------------------------------

	def CVLTR_resetIndexes(self):
		# clear out the indexes
		self.CVLTR_L_text.delete(0, 'end')
		self.CVLTR_M_text.delete(0, 'end')
		self.CVLTR_R_text.delete(0, 'end')
		self.CVLTR_length_text.delete(0, 'end')
		self.CVLTR_LX_text.delete(0, 'end')
		self.CVLTR_RX_text.delete(0, 'end')
		# erase the boxes in the pic
		self.pic.delete('boxL')
		self.pic.delete('boxR')
		# clear the highlighted area
		self.SeqTextWin_content.tag_delete('interested_tag')

  # ---------------------------------------------------

	def CVLTR_fill_in_ContigName_and_contigLength(self, event):
		print "X=%s Y=%s" % (event.x, event.y)
		self.CVLTR_cID_text.delete(0, END) # clear it first
		self.CVLTR_cID_text.insert(0, self.contigName) # fill it in
		self.CVLTR_contigLength_text.delete(0, END) # clear it first
		self.CVLTR_contigLength_text.insert(0, self.contigLength)  # fill it in

  # ---------------------------------------------------

	def CVLTR_fill_in_left_excluded_index(self, event):
		print "X=%s Y=%s" % (event.x, event.y)
		self.CVLTR_LX_text.delete(0, END) # clear it first
		pos = self.convert_pixelPos_to_seqPos(event.x)
		self.CVLTR_LX_text.insert(0, str(int(pos))) # fill it in

  # ---------------------------------------------------

	def CVLTR_fill_in_right_excluded_index(self, event):
		print "X=%s Y=%s" % (event.x, event.y)
		self.CVLTR_RX_text.delete(0, END) # clear it first
		pos = self.convert_pixelPos_to_seqPos(event.x)
		self.CVLTR_RX_text.insert(0, str(int(pos))) # fill it in

  # ---------------------------------------------------

	def CVLTR_fill_in_left_index(self, event):
		print "X=%s Y=%s" % (event.x, event.y)
		self.CVLTR_L_text.delete(0, END) # clear it first
		pos = self.convert_pixelPos_to_seqPos(event.x)
		self.CVLTR_L_text.insert(0, str(int(pos))) # fill it in

  # ---------------------------------------------------

	def CVLTR_fill_in_middle_index(self, event):
		print "X=%s Y=%s" % (event.x, event.y)
		self.CVLTR_M_text.delete(0, END) # clear it first
		pos = self.convert_pixelPos_to_seqPos(event.x)
		self.CVLTR_M_text.insert(0, str(int(pos))) # fill it in

  # ---------------------------------------------------

	def CVLTR_fill_in_right_index(self, event):
		print "X=%s Y=%s" % (event.x, event.y)
		self.CVLTR_R_text.delete(0, END) # clear it first
		pos = self.convert_pixelPos_to_seqPos(event.x)
		self.CVLTR_R_text.insert(0, str(int(pos))) # fill it in

  # ---------------------------------------------------

	def convert_pixelPos_to_seqPos(self, x):
		return ( (x-self.hSpace)*1.0 / self.adjustedGraphChartSizeX ) * self.maxGeneLen

  # ---------------------------------------------------

	def convert_seqPos_to_pixelPos(self, x):
		return ((x*1.0)/self.maxGeneLen) * self.adjustedGraphChartSizeX + self.hSpace

  # ---------------------------------------------------

	def displayMMError(self, type, info, hS, mGL, aGCSX, pY, bH, p):

		# pick the color according to which DIS
		barcolorMM = 'yellow'    # initial color
		if type == 'D':
			barcolorMM = 'blue'
		if type == 'I':
			barcolorMM = 'darkgreen'
		if type == 'S':
			barcolorMM = 'red'
		if type == 'XN':
			barcolorMM = 'gray'

		# draw it out
		for myPos in info:
			posX_start = hS + (myPos / mGL) * aGCSX
			posX_end = posX_start
			posY_start = pY
			posY_end = posY_start + bH
			p.create_rectangle(posX_start, posY_start, posX_end, posY_end, width=0, fill=barcolorMM)


#########################################

def main():
	contigViewerUserInputWindow().mainloop()

if __name__ == "__main__":
	main()

############## THE END ##################